SnapGene Server is no longer available for purchase or use by commercial third parties. This guide is provided for existing SnapGene Server users.
A list of currently supported commands, their parameters and a description of the command.
Common Parameters
Several commands use a common set of names to specify parameters:
See Enzyme Set Names.
See Reading Frame Names.
General Commands
Request Server Status
Requests status information for the server. Can be used to "ping" the server and make sure it is still operational. This request doesn't actually change any the server status information (lastRequest, requestCount).
| Input Parameters | |
|---|---|
| request | “status" |
| Output Parameters | |
|---|---|
| response |
“status" |
| serverVersion | Version number of the serverver |
| requestCount | Number of requests to the server (this request does not count) |
| lastRequest | Time of the last request (this request does not count) |
| uptime | Time the server has been running |
| license | State of the current license (if it is found, valid, expiration, etc.) |
| licenseExpiration | Date of the license expiration (YY-MM-DD) |
| Errors | |
|---|---|
| 0 | Success |
Report File Information
| Input Parameters | |
|---|---|
| request | “reportFileInfo" |
| inputFile | full path to input .dna file |
| Output Parameters | |
|---|---|
| response |
“reportFileInfo" |
| code | error code |
| sequenceLength | length of the sequence in base pairs |
| sequenceTopology | either “circular” or “linear" |
| serverIndex | index of server daemon that ran the report |
| Error Codes | |
|---|---|
| 0 | Success |
| 1 | Unable to open input .dna file or it isn’t a DNA file |
File Conversion
Import DNA File
Converts a file from a different DNA format to snapgene native .dna.
| Input Parameters | |
|---|---|
| request | “importDNAFile" |
| inputFile | full path to file to import |
| outputFile | Full path to .dna file to write to disk |
| enzymeSet | Enzyme set to save to this file (see list of possible names below) |
| minORFLen | Minimum detection length for ORFs to save to this file. Default is 75. |
| readingFrames | Reading frame option to save with this file (see list of possible names below). Default is ORFS |
| Output Parameters | |
|---|---|
| response |
“importDNAFile" |
| code | Return code for the request |
| Error Codes | |
|---|---|
| 0 | Success |
| 1 | Could not open input file |
| 2 | File type unsupported |
| 4 | Could not create output file |
| 5 | File stamping failure |
| 6 | Encoding failed |
| 7 | Sequence indexing failed |
| 8 | Recognition sequence indexing failed |
Export DNA File
Converts a file from snapgene native .dna to another file format. The outputFile must contain the extension .gb[1] or .fasta to convert to that particular format. Otherwise the output format is ambiguous and will the request will fail.
| Input Parameters | |
|---|---|
| request | “exportDNAFile" |
| inputFile | full path to file to read |
| outputFile | Full path of file to write to disk |
| exportFilter | Type of filter to export. Currently supported export filters are listed below. |
| Output Parameters | |
|---|---|
| response |
“exportDNAFile" |
| code | Return code for the request |
| Error Codes | |
|---|---|
| 0 | Success |
| 1 | Unable to open input file or the file is not a .dna file |
| 2 | Export filter unsupported |
| 3 | Internal exporting code failed |
Feature Commands
Detect Features
Detects feature on a .dna file. Will only detect new features present in the input feature database.
To detect from multiple databases, call this command repeatedly. Input and output parameters can be the same to modify the file in place.
For each new feature added, an optional note is appended to the feature's /note field (as specified in the genbank file format. This can also be viewed in Snapgene Desktop in the /note field at the bottom of the edit features dialog box.
| Input Parameters | |
|---|---|
| request | “detectFeatures" |
| inputFile | Full path to .dna file to read |
| outputFile | Full path of .dna file to write to disk |
| featureDatabase | Full path to feature database file. This should use the .dna file format but often uses the extension .ftrs (either will work. |
| Output Parameters | |
|---|---|
| response |
“detectFeatures" |
| code | Return code for the request |
| Error Codes | |
|---|---|
| 0 | Success |
| 1 | Unable to open input file |
| 2 | Unable to create output file |
| 3 | Feature database file does not exist |
Report Features
Returns the list of all features in the inputFile.
| Input Parameters | |
|---|---|
| request | “reportFeatures" |
| inputFile | Full path to .dna file to read |
| Output Parameters | |
|---|---|
| response |
“reportFeatures" |
| features | Array of features |
| code | Return code for the request |
| Error Codes | |
|---|---|
| 0 | Success |
| 1 | Unable to open input file |
The feature object is of the following format:
| Feature Objects | |
|---|---|
| name | name of the feature |
| type | type of the feature (there are many--I don't have them all listed here) |
| rangebegin | beginning base pair of the entire feature |
| rangeEnd | ending base pair of the entire feature |
| direction | can be one of the following: nondirectional, forward-directional, reverse-directional, bidirectional |
| segments | array of segments, introns are not included. |
| attributes | object with many key/value pairs, they are not all listed here. Values are string arrays. |
The segment object is of the following format:
| Segment Objects | |
|---|---|
| name | name of the segment |
| rangeBegin | beginning base pair of the segment |
| rangeEnd | ending base pair of the segment |
| color | color of the segment in #AAAAAAAA format |
| type | can be one of the following: standard, gap, run-on-translation |
Generate SVG Map
| Input Parameters | |
|---|---|
| request |
“generateSVGMap” |
| inputFile |
full path to .dna file to generate map from |
| linear |
true for linear map, false for circular map |
| showEnzymes |
True to show enzymes on the map |
| showPrimers |
True to show primers on the map |
| showFeatures |
True to show features on the map |
| showORFs |
True to display ORFs on the map |
| designSize |
set the requested size of the map in width x height. The actual size might be different because the map generation code performs extra logic to ensure the text graphical elements are all visible |
| outputSvgDom |
file to text fragment of the svg objects and tooltip DOM objects |
| outputSvgJSStatic |
file to text fragment of the javascript code required for hover/selection (static part) the static part can be shared for all maps for the same version of snapgene server. NOTE: this parameter is deprecated --- there is no need to generate JS files using generateSVGMap. Instead use the JS file in /opt/gslbiotech/snapgene-server/examples/js/map-seq-interactivity.js |
| outputSvgJSDynamic |
file to text fragment of the javascript code required for hover/selection (dynamic part). NOTE: this parameter is deprecated |
| outputSvgCss |
file to text fragment of the css code required for proper rendering of the SVG DOM. NOTE: this parameter is deprecated |
| optimize |
Removes extra SVG attributes that are not necessary for correctly rendering the SVG. |
| dataModel |
User defined attribute used to identify a particular map or sequence view. Useful when supporting multiple maps or sequences on the same page |
| dataId |
User defined attribute used to identify a particular map or sequence view. Useful when supporting multiple maps or sequences on the same page. |
| title |
Defines the title to use for the map. If the title is not defined or set to an empty string, then the default title (the filename without the extenion) is used. To clear the title completely from display, set the value to one space, e.g. “ “. |
| subtitle |
Defines the subtitle to use for the map. If the subtitle is not defined or set to an empty string, then the default title (the number of base pairs) is used. To clear the title completely from display, set the value to one space, e.g. “ “. |
| addMouseEvents |
Adds mouse handlers in the hittest region of the DOM. Default is true. |
| enzymeSet |
Override enzyme set to use saved with the .dna file |
| minORFLen |
Override the minimum ORF length saved with the .dna file |
| readingFrame |
Override the reading frame saved with the .dna file |
| Output Parameters | |
|---|---|
| response | "generateSVGMap" |
| code | Return code for the request |
| Errors | |
|---|---|
| 0 |
Success |
| 1 |
Update to open input for or it isn't a DNA file |
| 2 |
DNA file can be opened, requires updating, but couldn't be updated |
| 4 |
Unable to write SVG file |
| 5 |
Unable to write JS file |
| 6 |
Unable to write CSS file |
| 100 |
Internal Error |
Generates a web based map in several text file fragments.
The DOM object returned from outputSvgDOM will contain attributes with data-sequence-length and data-topology.
NOTE: This method used to be called generateMapParts.
Generate PNG Map
Generates a similar map compared to generateSVGMap except the output is PNG instead of Dom, JS and css files.
| Input Parameters |
|
|---|---|
| request |
"generatePNGMap" |
| inputFile |
full path to .dna file to generate map from |
| linear |
true for linear map, false for circular map |
| showEnzymes |
true to display enzymes |
| showFeatures |
true to display features |
| showPrimers |
true to display primers |
| showORFs |
true to display ORFs |
| designSize |
set the requested size of the map in width x height. The actual size might be different because the map generation code performs extra logic to ensure the text graphical elements are all visible |
| outputPng |
Output PNG file |
| enzymeSet |
Override enzyme set to use saved with the .dna file |
| minORFLen |
Override the minimum ORF length saved with the .dna file |
| readingFrame |
Override the reading frame saved with the .dna file |
| Output Parameters | |
|---|---|
| response | “generatePNGMap" |
| code | error code for the request |
| Error Codes | |
|---|---|
| 0 | Value 2 |
| 1 | Update to open input for or it isn't a DNA file |
| 2 | DNA file can be opened, requires updating, but couldn't be updated |
| 100 | Internal error |
Generate SVG Sequence
| Input Parameters | |
|---|---|
| request |
generateSVGSequence |
| inputFile |
full path to .dna file to generate a sequence from |
| showEnzymes |
true to display enzymes |
| showFeatures |
true to display features |
| showPrimers |
true to display primers |
| showTranslation |
true to display translations (this is currently unsupported) |
| outputSvgDom |
file to text fragment of the svg objects |
| outputSvgJSStatic |
file to text fragment of the javascript code required for hover/selection (static part) the static part can be shared for all maps for the same version of snapgene server. |
| outputSvgJSDynamic |
file to text fragment of the javascript code required for hover/selection (dynamic part) |
| outputSvgCss |
file to text fragment of the css code required for proper rendering of the SVG DOM |
| optimize |
Removes extra SVG attributes that are not necessary for correctly rendering the SVG. |
User defined attribute used to identify a particular map or sequence view. Useful when supporting multiple maps or sequences on the same page.
| User Defined | |
|---|---|
| dataID | User defined attribute used to identify a particular map or sequence view. |
| addMouseEvents |
Adds mouse handlers in the hittest region of the DOM. Default is true. |
| enzymeSet | Override enzyme set to use saved with the .dna file |
| minORFLen | Override the minimum ORF length saved with the .dna file |
| readingFrame | Override the reading frame saved with the .dna file |
| Output Parameters | |
|---|---|
| response | “generateSVGSequence" |
| code | Error code for |
| Error Codes | |
|---|---|
| 0 | Success. |
| 1 | Update to open input for or it isn't a DNA file. |
| 2 | DNA file can be opened, requires updating, but couldn't be updated. |
| 4 | Unable to write SVG file. |
| 5 | Unable to write JS file. |
| 6 | Unable to write CSS file. |
| 100 | Internal Error. |
Generates a web-based sequence in several fragments.
Import Primers from List
| Input Parameters: | |
|---|---|
| request |
importPrimersFromList |
| inputFile |
full path to input .dna file |
| inputPrimerFile |
full path to json file with primers to import |
| outputDnaFile |
full path to output .dna file with imported primers |
| requirePerfectMatch |
Integer value. 0 means no perfect match required. -1 means a perfect match is required for the entire primer. A value between 12-25 means a perfect match is required for that many bases of the primer. |
| requireUniqueBindingSite |
true/false. Require a unique binding site for the primer to be imported. |
| Output Parameters | |
|---|---|
| response | “importPrimersFromlist" |
| code | Error |
| Error Codes: | |
|---|---|
| 0 | Success. |
| 1 | Unable to open input dna file or it isn’t a DNA file. |
| 2 | DNA file can be opened, requires updating, but couldn’t be updated. |
| 3 | Unable to open primer file. |
| 4 | Unable to write output DNA file. |
| 100 | Internal error. |
Reads a list of primers in a json document and inserts them into a dna file. A new dna file is written.
The primer json document is of the following format:
array of objects of members. Members are:
[Primer Item 1, Primer Item 2, ...]
Each primer Item is:
{
"Name":"<primer name>",
"Sequence":"<primer sequence>",
"Notes":"<primer notes>"
}
Report Primers
| Input Parameters | |
|---|---|
| request | “reportPrimers" |
| inputDNAFile | full path to input. |
| Output Parameters | |
|---|---|
| response | “reportPrimers" |
| code | error code |
| primers | json array of primers (see schema below) |
| Error Codes: | |
|---|---|
| 0 | Success |
| 1 | Unable to open input dna file or it isn’t a DNA file. |
| 2 | DNA file can be opened, requires updating, but couldn’t be updated. |
| 100 | Internal error. |
Opens a .dna file and outputs a report in JSON for all primers saved to the .dna file.
JSON Schema for primers:
- color-user friendly name of color for primer
- length-length of sequence (this is always the same as property character length
- molecularWeight-formated string with weight of the primer
- name-name of the primer
- notes-notes for the primer
- percentGC-formated string with the percentage GC for the sequence
- sequence-actual sequence string of the primer
- sites-JSON array of binding sites
- bindingSiteStart: start of the binding site in BP
- bindingSiteEnd: ending of the binding site in BP
- meltingTemperature: degrees centigrade for melting
- strand: specified which side of the sequence the primer is attached to (“Top” or“Bottom”)
Example output with four primers. One of the primers has two binding sites:
{
"code": 0,
"primers": [
{
"color": "Black",
"length": 39,
"molecularWeight": "12,107.9 Da",
"name": "A206K.REV",
"notes": "<html><body>For introducing the monomerizing A206K mutation</body></html>",
"percentGC": "56% GC",
"sequence": "GTTGGGGTCTTTGCTCAGCTTGGACTGGGTGCTCAGGTA",
"sites": [
}, {
{
} ]
"bindingSiteEnd": 2593,
"bindingSiteStart": 2555,
"meltingTemperature": 71,
"strand": "Bottom"
"color": "Black",
"length": 39,
"molecularWeight": "11,868.7 Da",
"name": "A206K.FOR",
"notes": "<html><body>For introducing the monomerizing A206K mutation</body></html>",
"percentGC": "56% GC",
"sequence": "TACCTGAGCACCCAGTCCAAGCTGAGCAAAGACCCCAAC",
"sites": [
{
}, {
} ]
"bindingSiteEnd": 2593,
"bindingSiteStart": 2555,
"meltingTemperature": 71,
"strand": "Top"
"bindingSiteEnd": 2593,
"bindingSiteStart": 2555,
"meltingTemperature": 71,
"strand": "Top"
},
"response": "reportPrimers"
}
Report Enzymes
Report ORFs
| Input Parameters | |
|---|---|
| request | “reportEnzymes" |
| inputFile | full path to input .dna file. |
| enzymeSet | enzyme set to use (see list of possible names below). Otherwise enzyme set saved with file is used. |
| Output Parameters | |
|---|---|
| response | “reportEnzymes" |
| code | Error code. |
| setName | Name of the enzyme set. |
| count | Number of enzymes in library. |
| enzymes | json array of enzymes (see schema below). |
| Error Codes | |
|---|---|
| 0 | Success. |
| 1 | Unable to open input dna file or it isn’t a DNA file. |
| For each JSON object in the enzymes JSON array: |
|
|---|---|
| id: | Unique identifier for the enzyme. This should match with the map or sequence. |
| name: | Name of the enzyme. |
| Hits: | JSON array of hit objects (locations the enzyme cuts the sequence. |
|
Each hit object contains the following: |
|
| topCutPosition: |
Top location of the enzyme cut (this is the typical value displayed). |
| bottomCutPosition: |
If the cut is not blunt, then the bottom base position will be offset from the top. |
| methylationSensitive: |
true or false. |
| blocked: | true or false. |
Report ORFs
| Input Parameters | |
|---|---|
| request | “reportORFs" |
| inputFile | full path to input .dna fi |
| Ouput Parameters | |
|---|---|
| response | “reportORFs" |
| code | error code |
| ORFs | jsonArray of ORF objects. |
| Error Codes: | |
|---|---|
| 0 | Success |
| 1 | Unable to open input dna file or it isn’t a DNA file. |
| Response fields for each ORF: | |
|---|---|
| fullRangeBegin: |
First codon of ORF. |
| fullRangeEnd: | Last codon of ORF. |
| hitsStopCodon: |
True if fullRangeEnd is the last codon. It is possible the plasmid ends before a stop codon is encountered. |
| lacksStartCodon: |
In some configurations of ORF detection of a start codon is not required, if an ORF is detected without a start codon within the plasmid (i.e. the beginning of a linear map), this flag would be true. |